mahiai247
mahiai247 mahiai247
  • 04-03-2020
  • Mathematics
contestada

Quadrilateral ABCD ​ is inscribed in this circle.



What is the measure of ∠A ?

Enter your answer in the box.

Quadrilateral ABCD is inscribed in this circle What is the measure of A Enter your answer in the box class=

Respuesta :

shilpa85475 shilpa85475
  • 12-03-2020

The measure of ∠A is 137°.

Solution:

Given data:

Angle A = 43°

A quadrilateral inscribed in a circle is called cyclic quadrilateral.

∠A and ∠C are opposite angles in a cyclic quadrilateral.

In cyclic quadrilateral, opposite angles are supplementary.

⇒ m∠A + m∠C = 180°

⇒ 43° + m∠A = 180°

Subtract 43° from both sides of the equation, we get

⇒ m∠A = 137°

Hence the measure of ∠A is 137°.

Answer Link

Otras preguntas

What is the primary purpose of the Supremacy Clause?
accurate estimation 719-348
What is the additive inverse of -4a
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Tu as quels cours le jeudi matin?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take