jahmirlmiller
jahmirlmiller jahmirlmiller
  • 03-04-2020
  • Mathematics
contestada

Find the value of x.

Find the value of x class=

Respuesta :

surjithayer10 surjithayer10
  • 03-04-2020

Answer:

Step-by-step explanation:

6(6+x)=12²

36+6x=144

6x=144-36=108

x=18

Answer Link

Otras preguntas

|x+5| =3 plz help show steps
(A) Prepare an individual income tax return.George Large (SSN 000-11-1111) and his wife Marge Large (SSN 000-22-2222) live at 2000 Lakeview Drive, Cleveland, OH
Mario is a high school student writing a report about the shortage of fresh-produce stores in his community. He is now preparing his report for printing. The fi
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
at the end of the year dahir incorporated's balance of allowance for uncollectible accounts is $2700 (credit) before adjustment. the company estimates future un
In your job at the container factory, you are asked to design a rectangular box with volume 500 cm3 . The material for the sides and bottom costs $0.05 per cm2
2. Which equation shows converted to slope-intercept form?
Bailey has a jar of marbles. The bowl has 16 green, 20 red, and 14 yellow marbles. He reaches into the jar without looking and randomly grabs a marble. What is
Heme group (carries O.)
Divide the set of data into four quartiles. 4, 5, 7, 11, 12, 15, 16, 18