Traprqx
Traprqx Traprqx
  • 04-04-2020
  • Biology
contestada

Translation takes place in the what on a what?

Respuesta :

kapalczynskit
kapalczynskit kapalczynskit
  • 04-04-2020
Translation takes place in the Cytoplasm on the Nucleus
Answer Link

Otras preguntas

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
What is the sum of 6/10 plus 7/12
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
How many years does an apple tree live useful?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take