semanaved3
semanaved3 semanaved3
  • 02-08-2020
  • Mathematics
contestada

It is urgent plz answer

It is urgent plz answer class=

Respuesta :

anilpalhawas82
anilpalhawas82 anilpalhawas82
  • 02-08-2020

Answer:

my class is 8 th is I don't now this answer

Answer Link

Otras preguntas

Solve all the solutions of sinsquarex - cossquarex = 0 in the interval 0,2pi
I need help on exterior angles!
Sid is packing crushed ice into a cone-shaped cup. The cone has a height of 5 in. Its base has a diameter of 4 in. What is the volume of the cone?
Why is global warming an issue to organisms or speices? How could the high human population growth rate drive further extinctions of plants and animals?
Name a few important body functions that your nervous system controls on its own without you having to think about it much?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a
The octet rule states that, in chemical compounds, atoms tend to have ____. the electron configuration of a noble gas more protons than electrons eight electron
What is the solution of the system of equations? y = –2x + 8 y = x – 4
What is the distance between 407 squared and negative 68 squared