1kcloudyy 1kcloudyy
  • 02-10-2020
  • Mathematics
contestada

slope 5/2; (-6,7), what is the answer?

Respuesta :

steeleflag19
steeleflag19 steeleflag19
  • 04-10-2020

Answer: y = 5/2 x + 22

Step-by-step explanation: Use the formula y=mx+b in order to solve for b. Then plug in the known values.

Graph down below.

I hope this help you out. If not, I am so sorry.

Ver imagen steeleflag19
Answer Link

Otras preguntas

what are 2 points on the graph for 6x-5y=25
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
How many years does an apple tree live useful?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Graph the first six terms of a sequence where a1 = -10 and d = 3.
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How much money, in dollars, does one mole of nickels represent?