michelleyva69 michelleyva69

02-11-2020
Mathematics

contestada

For a rotation r(xº, P), which of the following is not true?

Respuesta :

aidenmcg2005 aidenmcg2005

09-11-2020

Answer:

The expression r(xº, P)A = B means that when point P is rotated xº about point A, its image is located at point B.

Step-by-step explanation:

i got it right

Answer Link

Otras preguntas

Compared to citizens of other nations, americans are _______ involved in politics and community affairs and vote at ________ levels.

Is the interaction that occurs among elements of the department of defense engaged us government?

You are on standby at a sporting event when an infant nearby suddenly begins to cough

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

True or False. An object's mass will change if you move it from the Earth to the Moon.

The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.

The root word graph means to _____. speak, write, read

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

great Britain is an example of a core nation True or False

Sid is packing crushed ice into a cone-shaped cup. The cone has a height of 5 in. Its base has a diameter of 4 in. What is the volume of the cone?