phynix17457 phynix17457

02-12-2020
Mathematics

contestada

plzzzz some one help I want step by step I'm confused What's 5⁄6 of £300

Respuesta :

Lexiisaweirdo Lexiisaweirdo

02-12-2020

Answer: 15

Step-by-step explanation:

Answer Link

Otras preguntas

Carbohydrates are an important macronutrient for fueling muscles. during exercise, where can the body obtain carbohydrate?

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

Which option would best fit in this diagram in the bubble labeled 1?

Which of the following shows the graph of y=In(-2x)

Rick was so successful with his sweet treats franchise that he opened several other sweet treats locations. rick could best be described as:

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.

What was one of the two major goals that the national organization for women work towards when it was first founded?

Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61