vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

The established supreme authority over Virginia
Marina abramovic's the artist is present took ________ to complete.
What is the solution set for this linear-quadratic system of equations? y=x^2-x-12 y-x-3=0
How were the Council members who handled taxes and treaties in Athens chosen?
Find the midpoint of the segment whose endpoints are (6, -10) and (20, 15)
What is the maximum temperature at which cold TCS food may be stored?
Which equation is correct for FON???
What poisonous gas is produced by uranium in rocks underneath a house?
What form of government did germany have during ww2?
A regular pentagon is shown. What is the measure of the radius, c, rounded to the nearest hundredth? Use an appropriate trigonometric ratio to solve.