Why does an object accelerate when it falls towards Earth's surface

Question

02-11-2016
Physics

contestada

Why does an object accelerate when it falls towards Earth's surface

Respuesta :

Otras preguntas

Mr. Ballard retired in 2018 at age 69 and made his first withdrawal of $35,000 from his traditional IRA. At year-end, the IRA balance was $441,000. In 2019, he

The scale of the drawing was 1 millimeters,2 meters in the drawing, the lawn in the backyard is 28 millimeters long, what is the length of the actual lawn

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

When faced with a number of tight deadlines, Mandy Moore often delegates work collectively. Recently she chose some fairly experienced employees to work on a hi

Determine whether the random variable is discrete or continuous. In each case, state the possible values of the random variable. (a) The number of points scor

The solid S has a base region B defined by the curves y = 5x − x 2 and y = x. (A) Find the volume of S if the cross-sections through S perpendicular to the x-ax

America has 36 total chromosomes in each body cell. After meerkat cells undergo the process of meiosis each gamete will have how many chromosomes

what's the square root of 36

What is the sum 1/2 + 2/5?

AL2006 AL2006 · Answer 1 · 2016-11-02T16:08:31+01:00

AL2006 AL2006

02-11-2016

There is a force of gravity acting downward on the object,
and no force acting upward on it.

Since the vertical forces on it are unbalanced, it accelerates
in the direction of the net vertical force, which is downward.

Answer Link