gamersr987 gamersr987

03-10-2021
English

contestada

please,don't laugh.........those beggars. a. for b. against c. at d. from

Respuesta :

03-10-2021

Answer:

c. at

Explanation:

Answer Link

unknown11158 unknown11158

03-10-2021

Answer:

please don't laugh at those beggars

Answer Link

Otras preguntas

Write v = 2x2 + 12x +1 in vertex form. A. y = (x+3)2 - 17 B. y = (x+4) C. y=2(x+3)2 – 17 D. y = 2(x + 2)2 + 12

A torus is formed by rotating a circle of radius r about a line in the plane of the circle that is a distance R (> r) from the center of the circle. Find the

The image shows Isotherms on a map.What temperature pattern do the isotherms show?A. lemperatures increase from south to north.B. There is a zone of low tempera

Convert the angle 0 = 345° to radians.

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Which sort algorithm starts with an initial sequence of size 1, which is assumed to be sorted, and increases the size of the sorted sequence in the array in eac

Which factor (s) have the most affect a person’s vital capacity? Rank in order from MOST effect (1) to least effect (5)

Puto el que lo lea Jajajajajajajaj >:)

Angie and Kenny play online video games. Angie buys 1 software package and 4 months of game play. Kenny buys 1 software package and 1 month of game play. each s

How are the solutions to the inequality -2x ≥ 10 different from the solutions to -2x > 10? Explain your reasoning.