chelsyyy18 chelsyyy18

04-02-2022
Chemistry

contestada

What is the solubility of NaCI in water at 0 degrees Celsius

Respuesta :

10194241 10194241

04-02-2022

Answer:

35.7 g

Kf - the cryoscopic constant of the solvent; b - the molality of the solution. So, the idea here is that you can only dissolve 35.7 g of sodium chloride, NaCl, in water at 0∘C.

Explanation:

Answer Link

Otras preguntas

Lighting a match changes mechanical energy, electristy, heat (choose) into Choose... mechanical energy, electristy, heat (choose).

Sam and Odel have been selling frozen pizzas for a class fundraiser. Sam has sold half as many pizzas as Odel. Together they have sold a total of 126 pizzas. Ho

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

someone please help me

From what geographic region do the Basque people originate? South America Europe Asia Africa

Mattie thinks she'll get along with the other workers at the restaurant because everyone who works there is..

QUICK!! Allen is taking a 150-mile trip by car. If he drives for 2 hours with an average speed of 60 miles per hour, how many miles will he still need to drive

look below giving brainliest

More algebra 1 homework Helppp plz n thank you

Alex was in a car accident then his mom died before the accident