806229 806229
  • 01-06-2022
  • Mathematics
contestada

HELP PLEASE Can someone at lest help me with the 2nd question a) b) and c) PLEASE AND THANKYOU

HELP PLEASE Can someone at lest help me with the 2nd question a b and c PLEASE AND THANKYOU class=

Respuesta :

nahzir324 nahzir324
  • 01-06-2022

Answer:

a

Step-by-step explanation:

I say you need to get mays age to even get lilacs age

Answer Link

Otras preguntas

Why did the french revolution happen and who's fault was it
31+34=90-n 45+1=70-k 6×9=41+m
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
What are the factors of 6x + 24?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5