msdeecarter msdeecarter
  • 04-06-2022
  • Mathematics
contestada

Find the measure of the remote exterior angle. m/x (198-5n)
m2y = (5n+37)
m²z = (n+7)

Respuesta :

topeadeniran2 topeadeniran2
  • 13-06-2022

The measure of the remote exterior angle is 128°.

How to calculate the angle?

From the information given, x = y + z. Therefore, .(198 - 5n) = (5n + 37( + (n + 7)

198 - 5n = 6n + 44

Collect like terms

154 = 6n + 5n

154 = 11n

n = 154/11

n = 14

The value of angle x will be:

= 198 - 5n

= 198 - 5(14)

= 198 - 70

= 128

Learn more about angles on:

brainly.com/question/25770607

#SPJ1

Answer Link

Otras preguntas

a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w
What is the difference between a settler an an explorer social studies?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Many assume that presidents with high __________ are more effective leaders.
Please help me with this one too !!!
Please help I'm trying to figure out 4-15 but i don't know how to.
Jacqui has grades of 87 and 84. if she wants an average of 78 what does she have to score
Which molecule carries the instructions for producing mrna? a. trna b. dna polymerase c. dna d. rna polymerase?
PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .
Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4