NataleyA471393 NataleyA471393

03-11-2022
Mathematics

contestada

last year 351 children signed up to play football in Johnston county. each single team had 27 players on its roster

Respuesta :

MarieaL454682 MarieaL454682

03-11-2022

Since there are 351 children

Since every single team had 27 players

To find the number of teams divide 351 by 27

The number of teams = 351/27

The number of teams = 13

There were 13 teams

The answer is A

Answer Link

Otras preguntas

an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.

Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?

find the prime factorization 504

What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims

which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5

Graph the six terms of a finite series where a1 = -3 and r = 1.5.

explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?