CyprianD302032 CyprianD302032
  • 03-11-2022
  • Mathematics
contestada

7th grade math I'm stuckhelp me fill in the blanks!

7th grade math Im stuckhelp me fill in the blanks class=

Respuesta :

AlenahL542872 AlenahL542872
  • 03-11-2022

ok

item price before tax sales tax price including tax

pillow 8 8 x 0.0725 = 0.58 8 + 0.58 = $8.58

blanket 22 22 x0.0725 = 1.595 22 + 1.595 = $23.595

trash can 14.5 14.5 x 0.0725 = 1.051 14.5 + 0.0725 =$15.55

Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Where did middle names come from
the reproductive system of a male mammal provides
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Help pl0x, Algebra 1
How do you put allele in a sentence
Fossils are most commonly found in which type of rock?
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.