BrewerI600749 BrewerI600749
  • 03-11-2022
  • Biology
contestada

When the northern hemisphere is tilted towards the sun, what season does itexperience?A. springB. winterC. fallD. summer

Respuesta :

RhykerM327589 RhykerM327589
  • 03-11-2022

When the northern hemisphere is tilted toward the sun (90° North Pole - latitudes between the Equator and North Pole) it is experiencing summer.

Answer Link

Otras preguntas

Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
what are the 2 major types of cofactors?
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
How well did feudalism establish order in the Middle ages?
How has water influenced the development of civilization in Africa
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
a antonym for biosphere
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
i need help with this question