nerialjun83 nerialjun83

03-02-2024
Computers and Technology

contestada

This refers to the concept or idea of the title.

Respuesta :

amachivictory amachivictory

03-02-2024

Answer:

character refers to the concept of idea

Answer Link

Otras preguntas

If the pOH of a cesium hydroxide solution is known to be 4.00. what is the (OH)? *Please round your answer to the appropriate number of significant figures. You

what is used as currency today that is not related to our money system

Children must have chores in the home yes or no ? Can some please give me a introduction and a hook for this...

Does heredity or the environment have more influence over an individual’s level of intelligence? Justify your response.

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

I seriously need help with this. I pay attention in class it's just so confusing!! I'm giving extra points. Now 15. Please tell the truth <3

I WILL GIVE BRAINLIEST The lines of constant pressure shown on the surface pressure diagram are called ___ isobars pressure lines fronts stationary lines

Which car traveled the farthest on 1 gallon of gas? Show your work.

Can someone write me a 4 paragraph of Black Lives Matter

Solve for x. (Round to the nearest hundredth)