darkmayem
darkmayem darkmayem
  • 02-01-2018
  • Mathematics
contestada

blank plus 2/3 equals 11/12

Respuesta :

Ngmez
Ngmez Ngmez
  • 02-01-2018
Your answer would be 3/12
Answer Link

Otras preguntas

The learning curve describes the ________ relationship between ________ and ________
Billy has 1 gallon of paint. He is going to pour it into a paint tray that measures 10 inches wide, 14 inches long, and 4 cm deep. Which of the following scenar
which is the correct way to rewrite the phrase? the house of Molly and Harriet A. Molly's and Harriet's house B. Molly and Harriet's house C. Mollies and Harrie
(75) pointsPlease help me on these questions ASAP!!!
A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?
Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?
What do the tympanic membranes do for the frog?
In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was